Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX6P1- Mst7-Erp2CT
(Plasmid #73922)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73922 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX6P1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Erp2 CT
  • Species
    S. cerevisiae (budding yeast)
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Cla1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer ACGTTTGGTGGTGGCGACCATCCTCCAAAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6P1- Mst7-Erp2CT was a gift from Blanche Schwappach (Addgene plasmid # 73922 ; http://n2t.net/addgene:73922 ; RRID:Addgene_73922)
  • For your References section:

    delta-COP contains a helix C-terminal to its longin domain key to COPI dynamics and function. Arakel EC, Richter KP, Clancy A, Schwappach B. Proc Natl Acad Sci U S A. 2016 Jun 21;113(25):6916-21. doi: 10.1073/pnas.1603544113. Epub 2016 Jun 13. 10.1073/pnas.1603544113 PubMed 27298352