Skip to main content

pMU103
(Plasmid #73934)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73934 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPZP201
  • Backbone size w/o insert (bp) 7132
  • Total vector size (bp) 11499
  • Modifications to backbone
    bar and GUS genes cassettes were inserted to the multiple cloning sites
  • Vector type
    Plant Expression
  • Selectable markers
    aadA

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    28 C is needed to grow Agrobacterium cells. SmR gene confers resistance to spectinomycin and streptomycin in bacteria
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    bar and GUS cassettes
  • Species
    bacteria
  • Promoter 35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR I (destroyed during cloning)
  • 3′ cloning site Hind III (not destroyed)
  • 5′ sequencing primer gaagtccagctgccagaaac
  • 3′ sequencing primer agtcgaccgtgtacgtctcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Discrepancies between Depositor's full sequence and Addgene's QC sequence are not of functional concern.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMU103 was a gift from Zhanyuan Zhang (Addgene plasmid # 73934 ; http://n2t.net/addgene:73934 ; RRID:Addgene_73934)
  • For your References section:

    Silencing of GmFAD3 gene by siRNA leads to low alpha-linolenic acids (18:3) of fad3-mutant phenotype in soybean [Glycine max (Merr.)]. Flores T, Karpova O, Su X, Zeng P, Bilyeu K, Sleper DA, Nguyen HT, Zhang ZJ. Transgenic Res. 2008 Oct;17(5):839-50. doi: 10.1007/s11248-008-9167-6. Epub 2008 Feb 7. 10.1007/s11248-008-9167-6 PubMed 18256901