Skip to main content
Addgene

pBF_HsPepT1
(Plasmid #73943)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73943 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBF
  • Backbone size w/o insert (bp) 3003
  • Total vector size (bp) 5225
  • Vector type
    make RNA for Xenopus oocyte injection

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PepT1
  • Alt name
    SLC15A1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2120
  • Entrez Gene
    SLC15A1 (a.k.a. HPECT1, HPEPT1, PEPT1)
  • Promoter beta globin
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHi (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer TTGTTCTTTTTGCAGAAGC
  • 3′ sequencing primer GCTTAGAGACTCCATTCGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBF_HsPepT1 was a gift from Simon Newstead (Addgene plasmid # 73943 ; http://n2t.net/addgene:73943 ; RRID:Addgene_73943)
  • For your References section:

    Crystal Structures of the Extracellular Domain from PepT1 and PepT2 Provide Novel Insights into Mammalian Peptide Transport. Beale JH, Parker JL, Samsudin F, Barrett AL, Senan A, Bird LE, Scott D, Owens RJ, Sansom MS, Tucker SJ, Meredith D, Fowler PW, Newstead S. Structure. 2015 Oct 6;23(10):1889-99. doi: 10.1016/j.str.2015.07.016. Epub 2015 Aug 27. 10.1016/j.str.2015.07.016 PubMed 26320580