Skip to main content

pJFRC7-RFPnls-PQRv2-mCD8:GFP
(Plasmid #73974)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73974 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJFRC7
  • Backbone manufacturer
    Janelia Farms
  • Backbone size w/o insert (bp) 8142
  • Total vector size (bp) 10235
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sfGFP
  • Alt name
    superfolder GFP
  • Insert Size (bp)
    1202
  • Promoter 20XUAS-HS
  • Tag / Fusion Protein
    • mCD8 (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCCACCTGATCTGCAAC
  • 3′ sequencing primer CCATTCATCAGTTCCATAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    RFP
  • Alt name
    TagRFP-T
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    816
  • Promoter 20XUAS-HS
  • Tag / Fusion Protein
    • nls (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGCGCCGGAGTATAAATAGAG
  • 3′ sequencing primer TCTGGAAGAGCCAAGAGCAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    all genes were synthesized

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJFRC7-RFPnls-PQRv2-mCD8:GFP was a gift from Brian Chen (Addgene plasmid # 73974 ; http://n2t.net/addgene:73974 ; RRID:Addgene_73974)
  • For your References section:

    Quantification of Protein Levels in Single Living Cells. Lo CA, Kays I, Emran F, Lin TJ, Cvetkovska V, Chen BE. Cell Rep. 2015 Dec 22;13(11):2634-44. doi: 10.1016/j.celrep.2015.11.048. Epub 2015 Dec 10. 10.1016/j.celrep.2015.11.048 PubMed 26686644