pJFRC7-RFPnls-PQRv2-mCD8:GFP
(Plasmid
#73974)
-
PurposeProtein Quantitation Reporter (PQR) to quantify a protein of interest in insect cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73974 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJFRC7
-
Backbone manufacturerJanelia Farms
- Backbone size w/o insert (bp) 8142
- Total vector size (bp) 10235
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesfGFP
-
Alt namesuperfolder GFP
-
Insert Size (bp)1202
- Promoter 20XUAS-HS
-
Tag
/ Fusion Protein
- mCD8 (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCCACCTGATCTGCAAC
- 3′ sequencing primer CCATTCATCAGTTCCATAGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRFP
-
Alt nameTagRFP-T
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)816
- Promoter 20XUAS-HS
-
Tag
/ Fusion Protein
- nls (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGCGCCGGAGTATAAATAGAG
- 3′ sequencing primer TCTGGAAGAGCCAAGAGCAT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byall genes were synthesized
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJFRC7-RFPnls-PQRv2-mCD8:GFP was a gift from Brian Chen (Addgene plasmid # 73974 ; http://n2t.net/addgene:73974 ; RRID:Addgene_73974) -
For your References section:
Quantification of Protein Levels in Single Living Cells. Lo CA, Kays I, Emran F, Lin TJ, Cvetkovska V, Chen BE. Cell Rep. 2015 Dec 22;13(11):2634-44. doi: 10.1016/j.celrep.2015.11.048. Epub 2015 Dec 10. 10.1016/j.celrep.2015.11.048 PubMed 26686644