Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-SEPT_Cdk2-T160E-siR
(Plasmid #73976)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73976 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-SEPT
  • Backbone size w/o insert (bp) 5020
  • Total vector size (bp) 7105
  • Vector type
    AAV
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cdk2-LHA-siR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1075
  • Mutation
    siRNA target site mutated
  • GenBank ID
    NM_001798
  • Entrez Gene
    CDK2 (a.k.a. CDKN2, p33(CDK2))

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc1 (unknown if destroyed)
  • 3′ cloning site Sac1 (unknown if destroyed)
  • 5′ sequencing primer ggcgcgccggagaggtgggttgggggccagtagaagg
  • 3′ sequencing primer gagctcgcagggaaggagacacaaaaagaagggg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cdk2-RHA-T160E
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1031
  • Mutation
    T160 mutated to Glu
  • GenBank ID
    NM_001798
  • Entrez Gene
    CDK2 (a.k.a. CDKN2, p33(CDK2))

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Cla1 (unknown if destroyed)
  • 3′ cloning site Sal1 (unknown if destroyed)
  • 5′ sequencing primer ATCGAT ccctagggttggactgaacaatcaaagttg
  • 3′ sequencing primer GTCGAC gtttccttccctccatcatctttcccctccc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-SEPT_Cdk2-T160E-siR was a gift from Steven Dowdy & Manuel Kaulich (Addgene plasmid # 73976 ; http://n2t.net/addgene:73976 ; RRID:Addgene_73976)
  • For your References section:

    Efficient CRISPR-rAAV engineering of endogenous genes to study protein function by allele-specific RNAi. Kaulich M, Lee YJ, Lonn P, Springer AD, Meade BR, Dowdy SF. Nucleic Acids Res. 2015 Apr 20;43(7):e45. doi: 10.1093/nar/gku1403. Epub 2015 Jan 13. 10.1093/nar/gku1403 PubMed 25586224