CpcB-Abies-grandisPHLS_CpcA
(Plasmid
#74000)
-
PurposeExpresses the Abies grandis PHLS as a fusion with the CpcB protein plus the CmR cassete in Synechocystis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74000 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBluescript KS+
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 2877
- Total vector size (bp) 7117
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePHLS and CmR
-
Alt nameAbies grandis phellandrene synthase (PHLS) fused to CpcB plus CmR
-
SpeciesSynechocystis and Abies grandis
-
Insert Size (bp)4240
-
GenBank IDAAF61453.1 AGF50922.1
- Promoter cpc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer aagagtccctgaatatcaaa
- 3′ sequencing primer ctagctcagagcattgatgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CpcB-Abies-grandisPHLS_CpcA was a gift from Anastasios Melis (Addgene plasmid # 74000 ; http://n2t.net/addgene:74000 ; RRID:Addgene_74000) -
For your References section:
Cyanobacterial production of plant essential oils. Formighieri C, Melis A. Planta. 2018 Oct;248(4):933-946. doi: 10.1007/s00425-018-2948-0. Epub 2018 Jul 4. 10.1007/s00425-018-2948-0 PubMed 29974209