Skip to main content

CpcB-Solanum-lycopersicumPHLS_CpcA
(Plasmid #74003)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74003 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript KS+
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2877
  • Total vector size (bp) 8384

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PHLS and CmR
  • Alt name
    Solanum lycopersicum phellandrene synthase (PHLS) fused to CpcB plus NPPS andCmR
  • Species
    Synechocystis and Solanum lycopersicum
  • Insert Size (bp)
    4213
  • GenBank ID
    ACO56896.1 AGF50922.1
  • Promoter cpc

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer aagagtccctgaatatcaaa
  • 3′ sequencing primer AGATCTCTAGTGGTTTAACG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Neryl diphosphate synthase from Solanum lycopersicum
  • Alt name
    NPPS
  • Insert Size (bp)
    784
  • GenBank ID
    ACO56895.1

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TCACATTCTAACGGGAGATA
  • 3′ sequencing primer ctagctcagagcattgatgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CpcB-Solanum-lycopersicumPHLS_CpcA was a gift from Anastasios Melis (Addgene plasmid # 74003 ; http://n2t.net/addgene:74003 ; RRID:Addgene_74003)
  • For your References section:

    Cyanobacterial production of plant essential oils. Formighieri C, Melis A. Planta. 2018 Oct;248(4):933-946. doi: 10.1007/s00425-018-2948-0. Epub 2018 Jul 4. 10.1007/s00425-018-2948-0 PubMed 29974209