CpcBfull-NaGLS fusion_CpcA
(Plasmid
#74004)
-
PurposeExpresses the Nicotiana attenuata GLS as a fusion with the CpcB protein plus the CmR cassete in Synechocystis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74004 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBluescript KS+
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 2877
- Total vector size (bp) 7963
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNaGLS and CmR
-
Alt nameNicotiana attenuata geranyl linalool synthase fused to CpcB plus CmR
-
SpeciesSynechocystis and Nicotiana attenuata
-
Insert Size (bp)5086
-
GenBank IDKJ755868 AGF50922.1
- Promoter cpc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer aagagtccctgaatatcaaa
- 3′ sequencing primer ctagctcagagcattgatgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CpcBfull-NaGLS fusion_CpcA was a gift from Anastasios Melis (Addgene plasmid # 74004 ; http://n2t.net/addgene:74004 ; RRID:Addgene_74004) -
For your References section:
Cyanobacterial production of plant essential oils. Formighieri C, Melis A. Planta. 2018 Oct;248(4):933-946. doi: 10.1007/s00425-018-2948-0. Epub 2018 Jul 4. 10.1007/s00425-018-2948-0 PubMed 29974209