Skip to main content

CpcBfull-NaGLS fusion_CpcA
(Plasmid #74004)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74004 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript KS+
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2877
  • Total vector size (bp) 7963

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NaGLS and CmR
  • Alt name
    Nicotiana attenuata geranyl linalool synthase fused to CpcB plus CmR
  • Species
    Synechocystis and Nicotiana attenuata
  • Insert Size (bp)
    5086
  • GenBank ID
    KJ755868 AGF50922.1
  • Promoter cpc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer aagagtccctgaatatcaaa
  • 3′ sequencing primer ctagctcagagcattgatgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CpcBfull-NaGLS fusion_CpcA was a gift from Anastasios Melis (Addgene plasmid # 74004 ; http://n2t.net/addgene:74004 ; RRID:Addgene_74004)
  • For your References section:

    Cyanobacterial production of plant essential oils. Formighieri C, Melis A. Planta. 2018 Oct;248(4):933-946. doi: 10.1007/s00425-018-2948-0. Epub 2018 Jul 4. 10.1007/s00425-018-2948-0 PubMed 29974209