FH95pUP95GpW (E4)
(Plasmid
#74034)
-
Purposelentiviral expression of Psd95 shRNA and Psd95-GFPpren fusion
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74034 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUGW
-
Backbone manufacturerDavid Baltimore (Addgene plasmid # 14883)
- Backbone size w/o insert (bp) 9941
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePsd95
-
gRNA/shRNA sequenceGGA CAT CCA GGC ACA CAA G
-
SpeciesR. norvegicus (rat)
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BstBI (destroyed during cloning)
- 5′ sequencing primer H1 tcgctatgtgttctgggaaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Map: FHUGW-(pUb)-HinDIII-SalI-XbaI-(P95)-KpnI-ApaI-SmaI-BamHI-(GFPpren-BsrGI-)-BsrBI-EcoRV-HinDIII-ClaI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FH95pUP95GpW (E4) was a gift from Robert Malenka & Oliver Schluter & Weifeng Xu (Addgene plasmid # 74034 ; http://n2t.net/addgene:74034 ; RRID:Addgene_74034) -
For your References section:
Molecular dissociation of the role of PSD-95 in regulating synaptic strength and LTD. Xu W, Schluter OM, Steiner P, Czervionke BL, Sabatini B, Malenka RC. Neuron. 2008 Jan 24;57(2):248-62. doi: 10.1016/j.neuron.2007.11.027. 10.1016/j.neuron.2007.11.027 PubMed 18215622