Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FHp5pUP95C3,5SGW (E5)
(Plasmid #74035)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74035 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUGW
  • Backbone manufacturer
    David Baltimore (Addgene plasmid # 14883)
  • Backbone size w/o insert (bp) 9941
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Psd95
  • gRNA/shRNA sequence
    GGA CAT CCA GGC ACA CAA G
  • Species
    H. sapiens (human)
  • Mutation
    PCR: C3,5S (tct aga cca cca tgg act Ctc tAt CGa tag tga caa cca ag)
  • Promoter H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BstBI (destroyed during cloning)
  • 5′ sequencing primer H1 tcgctatgtgttctgggaaa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Map: FHUGW-(pUb)-HinDIII-SalI-XbaI-(p95C3,5S)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FHp5pUP95C3,5SGW (E5) was a gift from Robert Malenka & Oliver Schluter & Weifeng Xu (Addgene plasmid # 74035 ; http://n2t.net/addgene:74035 ; RRID:Addgene_74035)
  • For your References section:

    Molecular dissociation of the role of PSD-95 in regulating synaptic strength and LTD. Xu W, Schluter OM, Steiner P, Czervionke BL, Sabatini B, Malenka RC. Neuron. 2008 Jan 24;57(2):248-62. doi: 10.1016/j.neuron.2007.11.027. 10.1016/j.neuron.2007.11.027 PubMed 18215622