FtsZ
(Plasmid
#74128)
-
PurposeExpresses FtsZ without a peptide
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74128 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCA24N
-
Backbone manufacturerNBRP-E.coli at NIG
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 5370
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFtsZ
-
SpeciesE. coli
-
Insert Size (bp)855
- Promoter T5-lac
-
Tag
/ Fusion Protein
- C-terminal linker sequence (G G S G S G S S) (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCGTAATAGCGAAGAGGCCCG
- 3′ sequencing primer cattactggatctatcaacaggag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original FtsZ expression construct was a kind gift from Jie Xiao (Addgene plasmid # 49764).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FtsZ was a gift from Lynne Regan (Addgene plasmid # 74128 ; http://n2t.net/addgene:74128 ; RRID:Addgene_74128)