Skip to main content

pCMV6-XL4 ASXL1 (1-479) 3x FLAG
(Plasmid #74262)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74262 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV6XL4
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 8000
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ASXL1
  • Alt name
    additional sex combs like 1, transcriptional regulator
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500
  • Mutation
    Contains ASXL1 amino acids 1-479
  • Entrez Gene
    ASXL1 (a.k.a. BOPS, MDS)
  • Promoter 5’LTR
  • Tag / Fusion Protein
    • 3X FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GGACTTTCCAAAATGTCG
  • 3′ sequencing primer ATTAGGACAAGGCTGGTGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV6-XL4 ASXL1 (1-479) 3x FLAG was a gift from Anjana Rao (Addgene plasmid # 74262 ; http://n2t.net/addgene:74262 ; RRID:Addgene_74262)
  • For your References section:

    Cancer-associated ASXL1 mutations may act as gain-of-function mutations of the ASXL1-BAP1 complex. Balasubramani A, Larjo A, Bassein JA, Chang X, Hastie RB, Togher SM, Lahdesmaki H, Rao A. Nat Commun. 2015 Jun 22;6:7307. doi: 10.1038/ncomms8307. 10.1038/ncomms8307 PubMed 26095772