pCMV6-XL4 ASXL1 (1-479) 3x FLAG
(Plasmid
#74262)
-
PurposeCancer-associated ASXL1 truncation mutant in mammalian expression vector
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV6XL4
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 6500
- Total vector size (bp) 8000
-
Modifications to backbonenone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameASXL1
-
Alt nameadditional sex combs like 1, transcriptional regulator
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1500
-
MutationContains ASXL1 amino acids 1-479
-
Entrez GeneASXL1 (a.k.a. BOPS, MDS)
- Promoter 5’LTR
-
Tag
/ Fusion Protein
- 3X FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GGACTTTCCAAAATGTCG
- 3′ sequencing primer ATTAGGACAAGGCTGGTGGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV6-XL4 ASXL1 (1-479) 3x FLAG was a gift from Anjana Rao (Addgene plasmid # 74262 ; http://n2t.net/addgene:74262 ; RRID:Addgene_74262) -
For your References section:
Cancer-associated ASXL1 mutations may act as gain-of-function mutations of the ASXL1-BAP1 complex. Balasubramani A, Larjo A, Bassein JA, Chang X, Hastie RB, Togher SM, Lahdesmaki H, Rao A. Nat Commun. 2015 Jun 22;6:7307. doi: 10.1038/ncomms8307. 10.1038/ncomms8307 PubMed 26095772