Skip to main content

5UAS zfSynaptophysin:GFP-5UAS DsRedExpress
(Plasmid #74317)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74317 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N2

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    synaptophysin
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    960
  • Promoter 5UAS
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer ATGGATGTTGCCAACCAGTT
  • 3′ sequencing primer TGGACGAGCTGTACAAGTAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    DsRedExpress
  • Insert Size (bp)
    700
  • Promoter 5UAS

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer ATGGCCTCCTCCGAGGACGT
  • 3′ sequencing primer CACCACCTGTTCCTGTAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    5UAS zfSynaptophysin:GFP-5UAS DsRedExpress was a gift from Martin Meyer & Stephen Smith (Addgene plasmid # 74317 ; http://n2t.net/addgene:74317 ; RRID:Addgene_74317)
  • For your References section:

    Evidence from in vivo imaging that synaptogenesis guides the growth and branching of axonal arbors by two distinct mechanisms. Meyer MP, Smith SJ. J Neurosci. 2006 Mar 29;26(13):3604-14. 10.1523/JNEUROSCI.0223-06.2006 PubMed 16571769