Skip to main content

pEGFP.mIKKβ
(Plasmid #74412)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74412 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP.C1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse IKKβ
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2289
  • Entrez Gene
    Ikbkb (a.k.a. IKK-2, IKK-B, IKK-beta, IKK2, IKK[b], IKKbeta, NFKBIKB)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gaagcgcgatcacatggtcctg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP.mIKKβ was a gift from Georgios Stathopoulos (Addgene plasmid # 74412 ; http://n2t.net/addgene:74412 ; RRID:Addgene_74412)
  • For your References section:

    Myeloid-derived interleukin-1beta drives oncogenic KRAS-NF-kappaBeta addiction in malignant pleural effusion. Marazioti A, Lilis I, Vreka M, Apostolopoulou H, Kalogeropoulou A, Giopanou I, Giotopoulou GA, Krontira AC, Iliopoulou M, Kanellakis NI, Agalioti T, Giannou AD, Jones-Paris C, Iwakura Y, Kardamakis D, Blackwell TS, Taraviras S, Spella M, Stathopoulos GT. Nat Commun. 2018 Feb 14;9(1):672. doi: 10.1038/s41467-018-03051-z. 10.1038/s41467-018-03051-z PubMed 29445180