pJA317
(Plasmid
#74488)
-
PurposeeF1alpha::puroR::mCherry::T2A::eGFP::d1ODC::wPRE has d1ODC degron
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74488 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJA291
- Total vector size (bp) 9287
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert named1ODC
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)124
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SbfI (not destroyed)
- 5′ sequencing primer gctcgccgaccactaccagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJA317 was a gift from Andrew Fire (Addgene plasmid # 74488 ; http://n2t.net/addgene:74488 ; RRID:Addgene_74488) -
For your References section:
Translation readthrough mitigation. Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. Nature. 2016 Jun 1;534(7609):719-723. doi: 10.1038/nature18308. 10.1038/nature18308 PubMed 27281202