Skip to main content

pKHR4
(Plasmid #74592)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74592 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluscript SK+
  • Backbone size (bp) 2878

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GTAAAACGACGGCCAGTGA
  • 3′ sequencing primer GGAAACAGCTATGACCATGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For sequencing multiple cloning sites (mcs) in the empty vector, linearize the plasmid by cutting at a restriction enzyme site, i.e., EcoRI or BamHI, because strong palindromic sequences flank the mcs make sequencing difficult.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKHR4 was a gift from David Grunwald (Addgene plasmid # 74592 ; http://n2t.net/addgene:74592 ; RRID:Addgene_74592)
  • For your References section:

    Precise Editing of the Zebrafish Genome Made Simple and Efficient. Hoshijima K, Jurynec MJ, Grunwald DJ. Dev Cell. 2016 Mar 21;36(6):654-67. doi: 10.1016/j.devcel.2016.02.015. 10.1016/j.devcel.2016.02.015 PubMed 27003937