Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pdRBFC-NS1-YN
(Plasmid #74723)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74723 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEarley-201
  • Backbone manufacturer
    The Plant Journal (2006) 45, 616–629
  • Total vector size (bp) 10757
  • Vector type
    Plant Expression ; double-stranded RNA labeling
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Influenza A virus NS1 protein, partial
  • Alt name
    NS1
  • Species
    Virus
  • Insert Size (bp)
    210
  • Promoter CaMV 35S
  • Tags / Fusion Proteins
    • HA
    • YFP N-terminal half domain

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer 35S-F: CGCAAGACCCTTCCTCTATATAAGGAA
  • 3′ sequencing primer OSC-R: ATCTCATTAAAGCAGGACTCTAGGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pdRBFC-NS1-YN was a gift from Aiming Wang (Addgene plasmid # 74723 ; http://n2t.net/addgene:74723 ; RRID:Addgene_74723)
  • For your References section:

    Visualizing double-stranded RNA distribution and dynamics in living cells by dsRNA binding-dependent fluorescence complementation. Cheng X, Deng P, Cui H, Wang A. Virology. 2015 Nov;485:439-51. doi: 10.1016/j.virol.2015.08.023. Epub 2015 Sep 7. 10.1016/j.virol.2015.08.023 PubMed 26351203