pJM103: 150bp Hps2 RFP on pCM66T
(Plasmid
#74744)
-
PurposepCM66T with shortened pHps2 promoter driving RFP expression (maxRFP = BBa_E1010)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCM66T (Addgene #74738)
- Total vector size (bp) 6141
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRFP (BioBrick part number BBa_E1010)
-
Alt namemaxRFP, mRFP
-
SpeciesSynthetic
-
Insert Size (bp)825
- Promoter pHps2, trimmed (extracted from Methylovorus glucosetrophus SIP3-4 genome)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgattcattaatgcagctggcac
- 3′ sequencing primer cctctgacacatgcagctccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
One of a series of plasmids with promoters of differing strengths in Methylovorous glucosetrophus SIP3-4, a RuMP cycle methylotroph:
Addgene # 74738: empty vector, made from pCM66.
Addgene # 74739: pJM100: no-promoter RFP control. Made from pCM66D (AddGene #74738)
Addgene # 74740: pJM101: pHps1 RFP on pCM66T
Addgene # 74741: pJM102: pHps2 RFP on pCM66T
Addgene # 74744: pJM103: 150bp Hps2 RFP on pCM66T
Addgene # 74745: pJM104: pTrc RFP on pCM66T
Addgene # 74746: pJM105: pTac RFP on pCM66T
Backbone is similar backbone to pAWP78 (AddGene plasmid 61263)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJM103: 150bp Hps2 RFP on pCM66T was a gift from Mary Lidstrom (Addgene plasmid # 74744 ; http://n2t.net/addgene:74744 ; RRID:Addgene_74744)