-
PurposeConstitutive ETV4 ORF, blasticidin selection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74982 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX_TRC311
-
Backbone manufacturerBroad Institute - Genetic Perturbation Platform
- Backbone size w/o insert (bp) 10065
- Total vector size (bp) 9882
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameETV4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1455
-
MutationS396N
-
GenBank IDNM_001079675
-
Entrez GeneETV4 (a.k.a. E1A-F, E1AF, PEA3, PEAS3)
- Promoter EF1a
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer WPRE-R
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX_TRC311 ETV4-L was a gift from William Hahn (Addgene plasmid # 74982 ; http://n2t.net/addgene:74982 ; RRID:Addgene_74982) -
For your References section:
ATXN1L, CIC, and ETS Transcription Factors Modulate Sensitivity to MAPK Pathway Inhibition. Wang B, Krall EB, Aguirre AJ, Kim M, Widlund HR, Doshi MB, Sicinska E, Sulahian R, Goodale A, Cowley GS, Piccioni F, Doench JG, Root DE, Hahn WC. Cell Rep. 2017 Feb 7;18(6):1543-1557. doi: 10.1016/j.celrep.2017.01.031. 10.1016/j.celrep.2017.01.031 PubMed 28178529