Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLX_TRC311 ETV4-L
(Plasmid #74982)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74982 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLX_TRC311
  • Backbone manufacturer
    Broad Institute - Genetic Perturbation Platform
  • Backbone size w/o insert (bp) 10065
  • Total vector size (bp) 9882
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ETV4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1455
  • Mutation
    S396N
  • GenBank ID
    NM_001079675
  • Entrez Gene
    ETV4 (a.k.a. E1A-F, E1AF, PEA3, PEAS3)
  • Promoter EF1a

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX_TRC311 ETV4-L was a gift from William Hahn (Addgene plasmid # 74982 ; http://n2t.net/addgene:74982 ; RRID:Addgene_74982)
  • For your References section:

    ATXN1L, CIC, and ETS Transcription Factors Modulate Sensitivity to MAPK Pathway Inhibition. Wang B, Krall EB, Aguirre AJ, Kim M, Widlund HR, Doshi MB, Sicinska E, Sulahian R, Goodale A, Cowley GS, Piccioni F, Doench JG, Root DE, Hahn WC. Cell Rep. 2017 Feb 7;18(6):1543-1557. doi: 10.1016/j.celrep.2017.01.031. 10.1016/j.celrep.2017.01.031 PubMed 28178529