Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pXPR_BRD003 sgKEAP1-1
(Plasmid #74985)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74985 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pXPR_BRD003
  • Backbone manufacturer
    Broad Institute - Genetic Perturbation Platform
  • Backbone size w/o insert (bp) 8318
  • Total vector size (bp) 8322
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KEAP1
  • gRNA/shRNA sequence
    CTTGTGGGCCATGAACTGGG
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GTATGTCTGTTGCTATTATGTCTACTATTCTTTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_BRD003 sgKEAP1-1 was a gift from William Hahn (Addgene plasmid # 74985 ; http://n2t.net/addgene:74985 ; RRID:Addgene_74985)
  • For your References section:

    KEAP1 loss modulates sensitivity to kinase targeted therapy in lung cancer. Krall EB, Wang B, Munoz DM, Ilic N, Raghavan S, Niederst MJ, Yu K, Ruddy DA, Aguirre AJ, Kim JW, Redig AJ, Gainor JF, Williams JA, Asara JM, Doench JG, Janne PA, Shaw AT, McDonald Iii RE, Engelman JA, Stegmeier F, Schlabach MR, Hahn WC. Elife. 2017 Feb 1;6:e18970. doi: 10.7554/eLife.18970. 10.7554/eLife.18970 PubMed 28145866