Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMSCV-puro-TTF-1-wt
(Plasmid #74990)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74990 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCV-puro
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TTF-1
  • Alt name
    NKX2-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1116
  • Mutation
    wild-type, full-length, without 3' UTR
  • GenBank ID
    NM_003317
  • Entrez Gene
    TTF1 (a.k.a. TTF-1, TTF-I)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho I (not destroyed)
  • 3′ cloning site Xho I (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-puro-TTF-1-wt was a gift from David Mu (Addgene plasmid # 74990 ; http://n2t.net/addgene:74990 ; RRID:Addgene_74990)
  • For your References section:

    Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome. Wood LW, Cox NI, Phelps CA, Lai SC, Poddar A, Talbot C Jr, Mu D. Sci Rep. 2016 Feb 25;6:19857. doi: 10.1038/srep19857. 10.1038/srep19857 PubMed 26912193