Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #75008)


Item Catalog # Description Quantity Price (USD)
Plasmid 75008 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer pBRrevBam (GGTGATGTCGGCGATATAGG)
  • 3′ sequencing primer pBEST-R (TCTCATGTTTGACAGCTTATC)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ZIKV_Trigger_27B was a gift from James Collins & Alexander Green (Addgene plasmid # 75008 ; ; RRID:Addgene_75008)
  • For your References section:

    Rapid, Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Pardee K, Green AA, Takahashi MK, Braff D, Lambert G, Lee JW, Ferrante T, Ma D, Donghia N, Fan M, Daringer NM, Bosch I, Dudley DM, O'Connor DH, Gehrke L, Collins JJ. Cell. 2016 May 6. pii: S0092-8674(16)30505-0. doi: 10.1016/j.cell.2016.04.059. 10.1016/j.cell.2016.04.059 PubMed 27160350