Skip to main content

Sfp pet29b C-terminal His Tag
(Plasmid #75015)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75015 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pet29b
  • Backbone size w/o insert (bp) 5370
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For protein expression grow in BL21s at 37 degrees until OD 0.8 is reached (approximately 4-6 hours), induce with 0.5 mM IPTG and grow at 16 degrees for 16 hours.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sfp
  • Alt name
    4'-phosphopantetheinyl transferase
  • Species
    B. subtilis
  • GenBank ID
    X63158.1
  • Promoter T7
  • Tag / Fusion Protein
    • His Tag (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter, forward primer)
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG (T7 terminator, reverse primer)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sfp pet29b C-terminal His Tag was a gift from Michael Burkart (Addgene plasmid # 75015 ; http://n2t.net/addgene:75015 ; RRID:Addgene_75015)
  • For your References section:

    One-pot chemo-enzymatic synthesis of reporter-modified proteins. Worthington AS, Burkart MD. Org Biomol Chem. 2006 Jan 7;4(1):44-6. Epub 2005 Nov 24. 10.1039/b512735a PubMed 16357994