-
PurposeExpresses the PPTase Sfp from B. subtilis; loads CoA analogues onto ACP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepet29b
- Backbone size w/o insert (bp) 5370
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor protein expression grow in BL21s at 37 degrees until OD 0.8 is reached (approximately 4-6 hours), induce with 0.5 mM IPTG and grow at 16 degrees for 16 hours.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSfp
-
Alt name4'-phosphopantetheinyl transferase
-
SpeciesB. subtilis
-
GenBank IDX63158.1
- Promoter T7
-
Tag
/ Fusion Protein
- His Tag (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter, forward primer)
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (T7 terminator, reverse primer) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Sfp pet29b C-terminal His Tag was a gift from Michael Burkart (Addgene plasmid # 75015 ; http://n2t.net/addgene:75015 ; RRID:Addgene_75015) -
For your References section:
One-pot chemo-enzymatic synthesis of reporter-modified proteins. Worthington AS, Burkart MD. Org Biomol Chem. 2006 Jan 7;4(1):44-6. Epub 2005 Nov 24. 10.1039/b512735a PubMed 16357994