Skip to main content

pAAV CD68-EGFP
(Plasmid #75034)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75034 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 4023
  • Total vector size (bp) 6070
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Species
    Synthetic
  • Insert Size (bp)
    1000
  • Promoter CD68

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCA
  • 3′ sequencing primer caacgggccacaactcctc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV CD68-EGFP was a gift from Bryan Roth (Addgene plasmid # 75034)
  • For your References section:

    Morphine paradoxically prolongs neuropathic pain in rats by amplifying spinal NLRP3 inflammasome activation. Grace PM, Strand KA, Galer EL, Urban DJ, Wang X, Baratta MV, Fabisiak TJ, Anderson ND, Cheng K, Greene LI, Berkelhammer D, Zhang Y, Ellis AL, Yin HH, Campeau S, Rice KC, Roth BL, Maier SF, Watkins LR. Proc Natl Acad Sci U S A. 2016 Jun 14;113(24):E3441-50. doi: 10.1073/pnas.1602070113. Epub 2016 May 31. 10.1073/pnas.1602070113 PubMed 27247388