Skip to main content

pMSCV-Zeo-PAX9
(Plasmid #75091)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75091 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSCV-Zeocin
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PAX9
  • Species
    H. sapiens (human)
  • Mutation
    wild-type, full-length, without native 3' UTR
  • Entrez Gene
    PAX9 (a.k.a. STHAG3)
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho I (not destroyed)
  • 3′ cloning site Xho I (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-Zeo-PAX9 was a gift from David Mu (Addgene plasmid # 75091 ; http://n2t.net/addgene:75091 ; RRID:Addgene_75091)
  • For your References section:

    Oncogenic cooperation and coamplification of developmental transcription factor genes in lung cancer. Kendall J, Liu Q, Bakleh A, Krasnitz A, Nguyen KC, Lakshmi B, Gerald WL, Powers S, Mu D. Proc Natl Acad Sci U S A. 2007 Oct 16;104(42):16663-8. Epub 2007 Oct 9. 10.1073/pnas.0708286104 PubMed 17925434