RCAS-sgATG7
(Plasmid
#75228)
-
PurposeAn adaption on the RCAS/tv-a somatic cell gene transfer system, for use in combination with an existing Cas9 background in the cell/mouse of interest. Depositors: Jane Fraser/Noor Gammoh
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75228 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneRCAS-Y
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 10500
-
Modifications to backboneAddition of U6 promoter-driven expression of CRISPR guide RNA against ATG7
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAutophagy Related 7
-
Alt nameATG7
-
gRNA/shRNA sequencegRNA against ATG7
-
SpeciesM. musculus (mouse)
-
Entrez GeneAtg7 (a.k.a. 1810013K23Rik, Agp7, Apg7l, Atg7l, Gm21553)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CTCTGCTGGTGGCCTCGCGTACCACTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RCAS-sgATG7 was a gift from Noor Gammoh (Addgene plasmid # 75228 ; http://n2t.net/addgene:75228 ; RRID:Addgene_75228)
Map uploaded by the depositor.