Skip to main content

NFATc1-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
(Plasmid #75236)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75236 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 75236-D50 50 μg of DNA in Tris buffer $495
DNA 75236-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    PX458-pSpCas9(BB)2A-GFP
  • Backbone manufacturer
    Feng Zhang (Plasmid #48138)
  • Backbone size w/o insert (bp) 9703
  • Total vector size (bp) 9703
  • Modifications to backbone
    CBH promoter exchanged for hEF1a promoter
  • Vector type
    CRISPR
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA against NFATc1
  • Alt name
    NFAT2
  • gRNA/shRNA sequence
    (gg)CCCGCCGGCGGATCACCCCT
  • Species
    H. sapiens (human)
  • GenBank ID
    ID: 4772 (GENE-ID)
  • Entrez Gene
    NFATC1 (a.k.a. NF-ATC, NF-ATc1.2, NFAT2, NFATc)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA contains at least 3 missmatches against human DNA (http://crispr.mit.edu) 2 additional nonmatching Guanidines added at 5' to enhance specificity (Kim, D. et al. Digenome-seq: genome-wide profiling of CRISPR-Cas9 off-target effects in human cells. Nat. Methods 12, 237–43, 1 p following 243 (2015).)
targets all isoforms.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NFATc1-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP) was a gift from Ria Baumgrass (Addgene plasmid # 75236 ; http://n2t.net/addgene:75236 ; RRID:Addgene_75236)
  • For your References section:

    Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333