Skip to main content
Addgene
Open Menu

pSaCas9_GFP
(Plasmid #64709)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64709 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 64709-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 64709-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4345
  • Total vector size (bp) 8398
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SaCas9-2A-GFP
  • Alt name
    Staphylococcus aureus Cas9
  • Alt name
    SauCas9
  • Species
    Synthetic
  • Insert Size (bp)
    4053
  • Promoter CAG
  • Tags / Fusion Proteins
    • 3xFLAG-SV40 NLS (N terminal on insert)
    • 2A-GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer ggctctagtgcctctgctaacc
  • 3′ sequencing primer M13R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSaCas9_GFP was a gift from Kiran Musunuru (Addgene plasmid # 64709 ; http://n2t.net/addgene:64709 ; RRID:Addgene_64709)
Related items:
Commonly requested with: