Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #75291)


Item Catalog # Description Quantity Price (USD)
Plasmid 75291 Standard format: Plasmid sent in bacteria as agar stab 1 $65 *

* Login to view industry pricing.


  • Vector backbone
  • Backbone manufacturer
    New England Biolabs
  • Backbone size (bp) 6648
  • Modifications to backbone
  • Vector type
    Bacterial Expression
  • Promoter tac
  • Tag / Fusion Protein
    • maltose-binding protein (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Any E. coli strain can be used for expression of fusion proteins; NEBExpress, BL21, or BL21(DE3) are good first choices
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMAL-c2E was a gift from Paul Riggs (Addgene plasmid # 75291 ; ; RRID:Addgene_75291)
  • For your References section:

    Mutations in maltose-binding protein that alter affinity and solubility properties. Walker IH, Hsieh PC, Riggs PD. Appl Microbiol Biotechnol. 2010 Sep;88(1):187-97. doi: 10.1007/s00253-010-2696-y. Epub 2010 Jun 10. 10.1007/s00253-010-2696-y PubMed 20535468