Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p-AAV-sh[control]
(Plasmid #75438)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 75438 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP
  • Alt name
    control vector - shRNA does not target any rat gene
  • gRNA/shRNA sequence
    AATTCTCCGAACGTGTCACGT
  • GenBank ID
    ENSRNOG00000008656
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (unknown if destroyed)
  • 3′ cloning site EcoR1 (unknown if destroyed)
  • 5′ sequencing primer none
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pAAV-D(+)-U6-siRNA-CMV-GFP was modified from pAAV-D(+)-U6-siRNA-CMV-zsGreen, which was obtained from Bing Wang, PhD, University of Pittsburgh
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-AAV-sh[control] was a gift from Edward Burton (Addgene plasmid # 75438 ; http://n2t.net/addgene:75438 ; RRID:Addgene_75438)
  • For your References section:

    shRNA targeting alpha-synuclein prevents neurodegeneration in a Parkinson's disease model. Zharikov AD, Cannon JR, Tapias V, Bai Q, Horowitz MP, Shah V, El Ayadi A, Hastings TG, Greenamyre JT, Burton EA. J Clin Invest. 2015 Jul 1;125(7):2721-35. doi: 10.1172/JCI64502. Epub 2015 Jun 15. 10.1172/JCI64502 PubMed 26075822