pEGB3omega1R Tnos:NptII:Pnos-SF (GB1181)
(Plasmid
#75471)
-
PurposeTranscriptional unit for kanamycin resistance gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75471 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDGB3omega1R
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
- Backbone size w/o insert (bp) 6698
- Total vector size (bp) 8269
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNptII
-
SpeciesEscherichia coli
-
Insert Size (bp)1571
- Promoter Agrobacterium tumefaciens Nopaline synthase promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GGTGGCAGGATATATTGTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGB3omega1R Tnos:NptII:Pnos-SF (GB1181) was a gift from Diego Orzaez (Addgene plasmid # 75471 ; http://n2t.net/addgene:75471 ; RRID:Addgene_75471) -
For your References section:
A modular toolbox for gRNA-Cas9 genome engineering in plants based on the GoldenBraid standard. Vazquez-Vilar M, Bernabe-Orts JM, Fernandez-Del-Carmen A, Ziarsolo P, Blanca J, Granell A, Orzaez D. Plant Methods. 2016 Feb 1;12:10. doi: 10.1186/s13007-016-0101-2. eCollection 2016. 101 [pii] PubMed 26839579