Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

373_ESR1 in pmiRGlo
(Plasmid #78134)


Item Catalog # Description Quantity Price (USD)
Plasmid 78134 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
    Estrogen Receptor
  • Species
    H. sapiens (human)
  • Mutation
    3'UTR containing miRNA binding sites
  • Entrez Gene
    ESR1 (a.k.a. ER, ESR, ESRA, ESTRR, Era, NR3A1)
  • Promoter PGK
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer Fluc-F1 (AGAAGCTGCGCGGTGGTGTTGTG)
  • 3′ sequencing primer T7terminal
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    373_ESR1 in pmiRGlo was a gift from Heidi Schwarzenbach (Addgene plasmid # 78134 ; ; RRID:Addgene_78134)
  • For your References section:

    Increased serum levels of circulating exosomal microRNA-373 in receptor-negative breast cancer patients. Eichelser C, Stuckrath I, Muller V, Milde-Langosch K, Wikman H, Pantel K, Schwarzenbach H. Oncotarget. 2014 Oct 30;5(20):9650-63. 10.18632/oncotarget.2520 PubMed 25333260