arr3a
(Plasmid
#78167)
-
Purposezf arr3a in pCRII-TOPO
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78167 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcRII-TOPO
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 3973
- Total vector size (bp) 5062
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer ATGGCTGACAAAGTTTACAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
arr3a was a gift from Stephan Neuhauss (Addgene plasmid # 78167 ; http://n2t.net/addgene:78167 ; RRID:Addgene_78167) -
For your References section:
Cone arrestin confers cone vision of high temporal resolution in zebrafish larvae. Renninger SL, Gesemann M, Neuhauss SC. Eur J Neurosci. 2011 Feb;33(4):658-67. doi: 10.1111/j.1460-9568.2010.07574.x. Epub 2011 Feb 8. 10.1111/j.1460-9568.2010.07574.x PubMed 21299656