pRSETb-rsGreenF
(Plasmid
#78181)
-
PurposeExpresses rsGreenF in E. coli strains.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78181 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRSETb
- Backbone size w/o insert (bp) 2860
- Total vector size (bp) 3580
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namersGreenF
-
Insert Size (bp)720
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-tag; Xpress tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGTTATTGCTCAGCGGTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSETb-rsGreenF was a gift from Peter Dedecker (Addgene plasmid # 78181 ; http://n2t.net/addgene:78181 ; RRID:Addgene_78181) -
For your References section:
Expression-Enhanced Fluorescent Proteins Based on Enhanced Green Fluorescent Protein for Super-resolution Microscopy. Duwe S, De Zitter E, Gielen V, Moeyaert B, Vandenberg W, Grotjohann T, Clays K, Jakobs S, Van Meervelt L, Dedecker P. ACS Nano. 2015 Oct 27;9(10):9528-41. doi: 10.1021/acsnano.5b04129. Epub 2015 Sep 9. 10.1021/acsnano.5b04129 PubMed 26308583