Skip to main content

pRSETb-pcDronpa
(Plasmid #78183)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78183 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRSETb
  • Backbone size w/o insert (bp) 2860
  • Total vector size (bp) 3535
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pcDronpa
  • Insert Size (bp)
    675
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-tag; Xpress tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGTTATTGCTCAGCGGTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSETb-pcDronpa was a gift from Peter Dedecker (Addgene plasmid # 78183 ; http://n2t.net/addgene:78183 ; RRID:Addgene_78183)
  • For your References section:

    Green-to-red photoconvertible Dronpa mutant for multimodal super-resolution fluorescence microscopy. Moeyaert B, Nguyen Bich N, De Zitter E, Rocha S, Clays K, Mizuno H, van Meervelt L, Hofkens J, Dedecker P. ACS Nano. 2014 Feb 25;8(2):1664-73. doi: 10.1021/nn4060144. Epub 2014 Jan 21. 10.1021/nn4060144 PubMed 24410188