Skip to main content
Addgene
Open Menu

pRK-flag-USP19
(Plasmid #78597)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78597 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 78597-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 78597-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pRK
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 11000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    flag-USP19
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3954
  • GenBank ID
    NM_006677.2
  • Entrez Gene
    USP19 (a.k.a. ZMYND9)
  • Promoter CMV
  • Tag / Fusion Protein
    • flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CCTACTCAGACAATGCGATGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Ye PCR amplified USP19 cDNA from a plasmid obtained from Simon Wing’s lab in Canada and then cloned them into the pRK FLAG vector we have in the lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRK-flag-USP19 was a gift from Yihong Ye (Addgene plasmid # 78597 ; http://n2t.net/addgene:78597 ; RRID:Addgene_78597)

  • For your References section:

    Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Lee JG, Takahama S, Zhang G, Tomarev SI, Ye Y. Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13. 10.1038/ncb3372 PubMed 27295555
Related items:
Commonly requested with: