36INS-pTet_GB
(Plasmid
#78681)
-
PurposeInsulated MoClo promoter for E. coli. 36nt DNA spacer empirically selected. Modified from BBa_R0040. [G:36INS-pTet:B]
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78681 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneDVA
- Backbone size w/o insert (bp) 2023
- Total vector size (bp) 2113
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInsulated pTet Promoter
-
Alt name36INS-pTet_GB
-
SpeciesSynthetic
-
Insert Size (bp)90
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
36INS-pTet_GB was a gift from Douglas Densmore (Addgene plasmid # 78681 ; http://n2t.net/addgene:78681 ; RRID:Addgene_78681) -
For your References section:
Reducing DNA context dependence in bacterial promoters. Carr SB, Beal J, Densmore DM. PLoS One. 2017 Apr 19;12(4):e0176013. doi: 10.1371/journal.pone.0176013. eCollection 2017. 10.1371/journal.pone.0176013 PubMed 28422998