Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

36INS-pTet_GB
(Plasmid #78681)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 78681 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    DVA
  • Backbone size w/o insert (bp) 2023
  • Total vector size (bp) 2113
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Insulated pTet Promoter
  • Alt name
    36INS-pTet_GB
  • Species
    Synthetic
  • Insert Size (bp)
    90

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer TGCCACCTGACGTCTAAGAA
  • 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    36INS-pTet_GB was a gift from Douglas Densmore (Addgene plasmid # 78681 ; http://n2t.net/addgene:78681 ; RRID:Addgene_78681)
  • For your References section:

    Reducing DNA context dependence in bacterial promoters. Carr SB, Beal J, Densmore DM. PLoS One. 2017 Apr 19;12(4):e0176013. doi: 10.1371/journal.pone.0176013. eCollection 2017. 10.1371/journal.pone.0176013 PubMed 28422998