BC-A1-015
(Plasmid
#78703)
-
PurposeA weak promoter drives the expression of a hypersensitive luxR mutant, which regulates expression of LVA-tagged GFP under the control of a weak RBS.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78703 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSB1C3
-
Backbone manufacturerRegistry of Standardized Biological Parts
- Backbone size w/o insert (bp) 2047
- Total vector size (bp) 4131
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Turbo
-
Growth instructionsReporter gene expression can also be assayed at room temperature (~25C).
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBBa_J23109-BBa_B0034-luxR(G2F)-Terminator-pLux-BBa_B0033-GFP(LVA)-Terminator
-
SpeciesSynthetic
-
Insert Size (bp)2084
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgccacctgacgtctaagaa (VF2)
- 3′ sequencing primer attaccgcctttgagtgagc (VR) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BC-A1-015 was a gift from Brian Chow (Addgene plasmid # 78703 ; http://n2t.net/addgene:78703 ; RRID:Addgene_78703) -
For your References section:
Toolbox for Exploring Modular Gene Regulation in Synthetic Biology Training. Magaraci MS, Bermudez JG, Yogish D, Pak DH, Mollov V, Tycko J, Issadore D, Mannickarottu SG, Chow BY. ACS Synth Biol. 2016 Apr 25. 10.1021/acssynbio.6b00057 PubMed 27111289