Cas9-GFP_sg_mAMPKa2
(Plasmid
#79005)
-
PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 2.
-
Depositing Lab
-
Depositing OrganizationSalk Institute for Biological Studies
Located in United States of America -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79005 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 79005-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 79005-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP (PX458)
- Total vector size (bp) 9300
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePrkaa2
-
gRNA/shRNA sequenceACAGGCATATGGTTGTCCAT
-
SpeciesM. musculus (mouse)
-
Entrez GenePrkaa2 (a.k.a. 2310008I11Rik, A830082D05, AMPKalpha2)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer TTTATGGCGAGGCGGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 79005-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 79005-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cas9-GFP_sg_mAMPKa2 was a gift from Reuben Shaw (Addgene plasmid # 79005 ; http://n2t.net/addgene:79005 ; RRID:Addgene_79005) -
For your References section:
AMPK governs lineage specification through Tfeb-dependent regulation of lysosomes. Young NP, Kamireddy A, Van Nostrand JL, Eichner LJ, Shokhirev MN, Dayn Y, Shaw RJ. Genes Dev. 2016 Mar 1;30(5):535-52. doi: 10.1101/gad.274142.115. 10.1101/gad.274142.115 PubMed 26944679