CSII-IDR2-owlTRIMCyp-FOS
(Plasmid
#79067)
-
PurposeExpress owl monkey TRIMCyp in mammalan cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79067 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCSII-BBN-IRES-DsRed
-
Backbone manufacturerCSII-BBN-IDR2
- Backbone size w/o insert (bp) 9866
- Total vector size (bp) 11354
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTRIM5Cyp (owl monkey)-FOS
-
SpeciesAotus trivirgatus
-
Insert Size (bp)1422
-
GenBank IDAAT73777.1
- Promoter CMV
-
Tag
/ Fusion Protein
- OneSTrEP-FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer CAGAGCTGGTTTAGTGAACC
- 3′ sequencing primer GCCAAAAGACGGCAATATGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CMV promoter and IRES DsRed co expression
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CSII-IDR2-owlTRIMCyp-FOS was a gift from Wesley Sundquist (Addgene plasmid # 79067 ; http://n2t.net/addgene:79067 ; RRID:Addgene_79067) -
For your References section:
Primate TRIM5 proteins form hexagonal nets on HIV-1 capsids. Li YL, Chandrasekaran V, Carter SD, Woodward CL, Christensen DE, Dryden KA, Pornillos O, Yeager M, Ganser-Pornillos BK, Jensen GJ, Sundquist WI. Elife. 2016 Jun 2;5. pii: e16269. doi: 10.7554/eLife.16269. 10.7554/eLife.16269 PubMed 27253068