pSicoR (EGFP) shPnky-2
(Plasmid
#79142)
-
PurposeStable expression of shRNA targeting mouse Pnky. The shRNA (and EGFP) can be excised by the addition of Cre
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79142 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSicoR
- Backbone size w/o insert (bp) 7552
-
Vector typeMammalian Expression, Lentiviral, RNAi, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshPnky-2
-
gRNA/shRNA sequenceGATGACGTGGAGAGGATTTTTCAAGAGAAAATCCTCTCCACGTCATCTTTTTTC
-
SpeciesM. musculus (mouse)
-
Entrez GeneGm30731 (a.k.a. Pnky, lnc-pou3f2)
- Promoter U6 for the shRNA and CMV for EGFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer tgcaggggaaagaatagtagac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSicoR (EGFP) shPnky-2 was a gift from Daniel Lim (Addgene plasmid # 79142 ; http://n2t.net/addgene:79142 ; RRID:Addgene_79142) -
For your References section:
The long noncoding RNA Pnky regulates neuronal differentiation of embryonic and postnatal neural stem cells. Ramos AD, Andersen RE, Liu SJ, Nowakowski TJ, Hong SJ, Gertz CC, Salinas RD, Zarabi H, Kriegstein AR, Lim DA. Cell Stem Cell. 2015 Apr 2;16(4):439-47. doi: 10.1016/j.stem.2015.02.007. Epub 2015 Mar 19. 10.1016/j.stem.2015.02.007 PubMed 25800779