Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCOLA-T7-WspR:G249A
(Plasmid #79163)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79163 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCOLADuet
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 3719
  • Total vector size (bp) 4709
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    WspR
  • Species
    P. areuginosa
  • Insert Size (bp)
    1041
  • Mutation
    G249A
  • GenBank ID
    NC_002516.2
  • Entrez Gene
    wspR (a.k.a. PA3702)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer ttgtacacggccgcataatc
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCOLA-T7-WspR:G249A was a gift from Ming Hammond (Addgene plasmid # 79163 ; http://n2t.net/addgene:79163 ; RRID:Addgene_79163)
  • For your References section:

    Next-generation RNA-based fluorescent biosensors enable anaerobic detection of cyclic di-GMP. Wang XC, Wilson SC, Hammond MC. Nucleic Acids Res. 2016 Jul 5. pii: gkw580. 10.1093/nar/gkw580 PubMed 27382070