PGL3-Mgea5 (-1034 to +181 bp)
(Plasmid
#79269)
-
PurposeTo identify the Cis and Trans acting elements that control Mgea5 gene transcription.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79269 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePGL3-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMgea5 promoter element
-
Alt nameMgea5 gene fragment -1034 to +181 bp
-
SpeciesM. musculus (mouse)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CCCTTACGCACACCGCACACTC
- 3′ sequencing primer TGGCTCTCCTTCTGCACCAT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGL3-Mgea5 (-1034 to +181 bp) was a gift from Steven Jones (Addgene plasmid # 79269) -
For your References section:
E2F1 Transcription Factor Regulates O-linked N-acetylglucosamine (O-GlcNAc) Transferase and O-GlcNAcase Expression. Muthusamy S, Hong KU, Dassanayaka S, Hamid T, Jones SP. J Biol Chem. 2015 Dec 25;290(52):31013-24. doi: 10.1074/jbc.M115.677534. Epub 2015 Nov 2. 10.1074/jbc.M115.677534 PubMed 26527687