Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pScalps_Puro_mTet2 catalytic domain HxD
(Plasmid #79611)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 79611 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7740
  • Total vector size (bp) 10542
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
    Ten Eleven Translocation methylcytosine dioxygenase 2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    Mutant Tet2 with H1302Y, D1304A substitutions in the signature HxD motif
  • GenBank ID
  • Entrez Gene
    Tet2 (a.k.a. Ayu17-44, Ayu17-449, E130014J05Rik, mKIAA1546)
  • Tag / Fusion Protein
    • Myc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCTTCTCGCTTCTGTTCG
  • 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pScalps_Puro_mTet2 catalytic domain HxD was a gift from Silvia Monticelli (Addgene plasmid # 79611 ; ; RRID:Addgene_79611)
  • For your References section:

    TET2 Regulates Mast Cell Differentiation and Proliferation through Catalytic and Non-catalytic Activities. Montagner S, Leoni C, Emming S, Della Chiara G, Balestrieri C, Barozzi I, Piccolo V, Togher S, Ko M, Rao A, Natoli G, Monticelli S. Cell Rep. 2016 May 17;15(7):1566-79. doi: 10.1016/j.celrep.2016.04.044. Epub 2016 May 5. 10.1016/j.celrep.2016.04.044 PubMed 27160912