-
PurposeExpression of catalytically inactive mouse Tet2
-
Depositing Lab
-
Depositing OrganizationInstitute for Research in Biomedicine, Switzerland
Located in Switzerland -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79611 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepScalps
- Backbone size w/o insert (bp) 7740
- Total vector size (bp) 10542
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTet2
-
Alt nameTen Eleven Translocation methylcytosine dioxygenase 2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2836
-
MutationMutant Tet2 with H1302Y, D1304A substitutions in the signature HxD motif
-
GenBank IDNM_001040400
-
Entrez GeneTet2 (a.k.a. Ayu17-449, E130014J05Rik, mKIAA1546)
-
Tag
/ Fusion Protein
- Myc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCTTCTCGCTTCTGTTCG
- 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pScalps_Puro_mTet2 catalytic domain HxD was a gift from Silvia Monticelli (Addgene plasmid # 79611 ; http://n2t.net/addgene:79611 ; RRID:Addgene_79611) -
For your References section:
TET2 Regulates Mast Cell Differentiation and Proliferation through Catalytic and Non-catalytic Activities. Montagner S, Leoni C, Emming S, Della Chiara G, Balestrieri C, Barozzi I, Piccolo V, Togher S, Ko M, Rao A, Natoli G, Monticelli S. Cell Rep. 2016 May 17;15(7):1566-79. doi: 10.1016/j.celrep.2016.04.044. Epub 2016 May 5. 10.1016/j.celrep.2016.04.044 PubMed 27160912
Map uploaded by the depositor.