AAV-FLEX-EGFP-mir30(Scn9a)
(Plasmid #79672)

• Purpose: Cre-dependent knockdown of Scn9a (Nav1.7)
• Depositing Lab: Scott Sternson
• Publication: Branco et al Cell. 2016 Jun 16;165(7):1749-61. doi: 10.1016/j.cell.2016.05.019.

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 4978
• Total vector size (bp): 6087
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: EGFP
• gRNA/shRNA sequence: Scn9a
• Species: M. musculus (mouse); jellyfish
• GenBank ID: NM_001290674.1
• Entrez Gene: Scn9a (a.k.a. Nav1.7, PN1, mKIAA4197)
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nhe1 (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: ctgacaacgggccacaactc
• 3′ sequencing primer: GTATATGTGCTGCCGAAGCG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry