pAM-PAT-ProUBQ10 GW
(Plasmid
#79751)
-
Purpose(Empty Backbone) binary DEST vector for plant expression
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79751 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBinary vector pAMPAT-MCS
-
Modifications to backboneexchange of Pro35S to ProUBQ10
-
Vector typePlant Expression
- Promoter ProUBQ10
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gaccggcaacaggattcaatcttaag
- 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byArp Schnittger, Stefan Pusch, Universität Hamburg
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM-PAT-ProUBQ10 GW was a gift from Nico Dissmeyer & Arp Schnittger (Addgene plasmid # 79751 ; http://n2t.net/addgene:79751 ; RRID:Addgene_79751) -
For your References section:
Phenotypes on demand via switchable target protein degradation in multicellular organisms. Faden F, Ramezani T, Mielke S, Almudi I, Nairz K, Froehlich MS, Hockendorff J, Brandt W, Hoehenwarter W, Dohmen RJ, Schnittger A, Dissmeyer N. Nat Commun. 2016 Jul 22;7:12202. doi: 10.1038/ncomms12202. 10.1038/ncomms12202 PubMed 27447739