pLEELA
(Plasmid
#79752)
-
Purpose(Empty Backbone) binary DEST vector for plant expression
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneBinary vector pAMPAT-MCS
-
Modifications to backboneintroduction of intron 3' of 35S promoter
-
Vector typePlant Expression
- Promoter 2xPro35S
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gaccggcaacaggattcaatcttaag
- 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMarc Jakoby
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEELA was a gift from Nico Dissmeyer & Marc Jakoby (Addgene plasmid # 79752 ; http://n2t.net/addgene:79752 ; RRID:Addgene_79752) -
For your References section:
FRU (BHLH029) is required for induction of iron mobilization genes in Arabidopsis thaliana. Jakoby M, Wang HY, Reidt W, Weisshaar B, Bauer P. FEBS Lett. 2004 Nov 19;577(3):528-34. 10.1016/j.febslet.2004.10.062 PubMed 15556641