pAM-PAT-ProTTG1 GW
(Plasmid
#79753)
-
Purpose(Empty Backbone) binary DEST vector for plant expression
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79753 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneBinary vector pAMPAT-MCS
-
Modifications to backboneexchange of Pro35S to ProTTG1
-
Vector typePlant Expression
- Promoter ProTTG1
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gaccggcaacaggattcaatcttaag
- 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMartin Hülskamp, Daniel Buoyer
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM-PAT-ProTTG1 GW was a gift from Nico Dissmeyer & Martin Hulskamp (Addgene plasmid # 79753 ; http://n2t.net/addgene:79753 ; RRID:Addgene_79753) -
For your References section:
Two-dimensional patterning by a trapping/depletion mechanism: the role of TTG1 and GL3 in Arabidopsis trichome formation. Bouyer D, Geier F, Kragler F, Schnittger A, Pesch M, Wester K, Balkunde R, Timmer J, Fleck C, Hulskamp M. PLoS Biol. 2008 Jun 10;6(6):e141. doi: 10.1371/journal.pbio.0060141. 10.1371/journal.pbio.0060141 PubMed 18547143